JVAS announces awards - Four best research articles (one each from basic, production, para-clinical and clinical subjects) and one best short communication will be adjudged for awards each year!!!

Journal of Veterinary and Animal Sciences

Volume: 54 Issue: 3

  • Open Access
  • Research Article

First report of entomopathogenic fungi, Aspergillus tamarii (Eurotiales: Trichocomaceae) on Musca domestica (Diptera: Muscidae) larvae

M. Jemimah Persis1, M. Jayakumar1* and S. Diya1

 

Department of Zoology, University of Madras Guindy Campus, Chennai 600025 Tamil Nadu, India

*Corresponding author: [email protected], Ph. 9444108483

Year: 2023, Page: 799-807, Doi: https://doi.org/10.51966/jvas.2023.54.3.:799-807

Received: April 19, 2023 Accepted: July 19, 2023 Published: Sept. 30, 2023

Abstract

A fungus isolated from mango wasp was found to be pathogenic to houseflies.The isolated fungus was identified asAspergillus tamarii using morphological characteristics and by comparative nucleotide sequence analysis of ITS regions. Fragments covering the region encoding ITS-1, 5.8S rDNA, and ITS-2 were amplified using the universal primers, ITS1 (TCCGTAGGTGAACCTGCGG) and ITS2 (TCCTCCGCTTATTGATATGC). The results of bioassays against early second instar larva showed dose-dependent mortality. Larvicidal activity was carried out at eight different concentrations viz, 1x106 , 1x107 , 1x108 , 2x106 , 2x107 , 2x108 , 3x106 , 3x107 , and 3x108 spores/ml. Among the two different methods of bioassays, bait method showed highest mortality. Beauveria bassiana was used as a positive control. Tween 80 (0.05%) was used as negative control. Larval mortality commences from day 3 until pupation in both bait and immersion methods.The least LC50 value observed for bait method was 5.28x107 spores/ml followed by immersion method, 5.12x109 spores/ml. On the other hand, the larva treated with commercial fungal strain, Beauveria bassiana showed an LC50 value of 1.26x108 spores/ml and 1.32x108 spores/ml for bait and immersion methods, respectively. Visual observation of mycosis was noticed on treated larva. Treated larvae had extensive growth of fungal hyphae on the larval surface.Scanning Electron Microscopy studies of treated larvae clearly showed the process of fungal infection. Longitudinal section of the treated larva showed fungal hyphae on the haemocoel.

Keywords: Musca domestica, Aspergillus tamarii, larvicidal, biocontrol agent

Cite this article

Jemimah, P.M., Jayakumar, M. and Diya, S. 2023. First report of entomopathogenic fungi, Aspergillus tamarii (Eurotiales: Trichocomaceae) on Musca domestica (Diptera: Muscidae) larvae. J. Vet. Anim. Sci. 54(3):799-807

DOI: https://doi.org/10.51966/jvas.2023.54.3.:799-807

Views
597
Downloads
382
Citations